ID: 1045306892_1045306895

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1045306892 1045306895
Species Human (GRCh38) Human (GRCh38)
Location 8:100965415-100965437 8:100965435-100965457
Sequence CCTCCCTCTACATGTGGGAATTA TTACAATTCAAGATGAGATTTGG
Strand - +
Off-target summary No data {0: 2206, 1: 9725, 2: 12425, 3: 11533, 4: 7780}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!