ID: 1045336047_1045336069

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1045336047 1045336069
Species Human (GRCh38) Human (GRCh38)
Location 8:101205373-101205395 8:101205421-101205443
Sequence CCGGCCCCCGCCCCGTTTCCCGG CCGCTGCCGCTCACCCGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 63, 4: 554} {0: 1, 1: 0, 2: 0, 3: 18, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!