ID: 1045336061_1045336064

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1045336061 1045336064
Species Human (GRCh38) Human (GRCh38)
Location 8:101205401-101205423 8:101205417-101205439
Sequence CCGCGGCGTCAGCACCGCCCCCG GCCCCCGCTGCCGCTCACCCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 266} {0: 1, 1: 0, 2: 3, 3: 42, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!