ID: 1045440601_1045440605

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1045440601 1045440605
Species Human (GRCh38) Human (GRCh38)
Location 8:102205166-102205188 8:102205217-102205239
Sequence CCATCTGCAGCTTTATCATTAAA CAGTATCTACAAATGAAATTTGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 2, 3: 22, 4: 309} {0: 1, 1: 1, 2: 0, 3: 21, 4: 364}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!