ID: 1045467594_1045467602

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1045467594 1045467602
Species Human (GRCh38) Human (GRCh38)
Location 8:102484757-102484779 8:102484798-102484820
Sequence CCTGATGTTCAGATGTGTTCGGA GTTCTTGGTCTGGCTGGCTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 21, 2: 681, 3: 539, 4: 461}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!