ID: 1045539069_1045539073

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1045539069 1045539073
Species Human (GRCh38) Human (GRCh38)
Location 8:103064859-103064881 8:103064891-103064913
Sequence CCTTACATTGGACCTCTTTATTA CCAGCAATAGGAAATTGATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 133} {0: 1, 1: 0, 2: 1, 3: 19, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!