ID: 1045544260_1045544267

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1045544260 1045544267
Species Human (GRCh38) Human (GRCh38)
Location 8:103113996-103114018 8:103114024-103114046
Sequence CCCTTATTGGCCAGCTTGGGTGA CCATCTCTGCAGTGGGAAGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 38, 4: 325}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!