ID: 1045587833_1045587838

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1045587833 1045587838
Species Human (GRCh38) Human (GRCh38)
Location 8:103559254-103559276 8:103559279-103559301
Sequence CCAGCCTTCTGATCCTGATTTTC AATTAGCCTTCCCATTAGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 30, 4: 275} {0: 1, 1: 1, 2: 1, 3: 22, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!