ID: 1045605418_1045605422

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1045605418 1045605422
Species Human (GRCh38) Human (GRCh38)
Location 8:103768302-103768324 8:103768355-103768377
Sequence CCAGCCACTGGCTGCCAGAAACT CACTTTTTATGAGAAGCATATGG
Strand - +
Off-target summary No data {0: 1, 1: 2, 2: 6, 3: 23, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!