ID: 1045610082_1045610086

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1045610082 1045610086
Species Human (GRCh38) Human (GRCh38)
Location 8:103829548-103829570 8:103829582-103829604
Sequence CCTTTGCAGCAACATAGATCGAG TATCCTAACCAATTTGATGCAGG
Strand - +
Off-target summary {0: 1, 1: 57, 2: 854, 3: 2932, 4: 5574} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!