ID: 1045735733_1045735738

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1045735733 1045735738
Species Human (GRCh38) Human (GRCh38)
Location 8:105294703-105294725 8:105294739-105294761
Sequence CCAAAAATGATACACTGGAACAG TAATTTGGGAGATGGTGCTCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 14, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!