ID: 1045777753_1045777758

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1045777753 1045777758
Species Human (GRCh38) Human (GRCh38)
Location 8:105825744-105825766 8:105825786-105825808
Sequence CCTCATTGCCTTCAGGATCAAGT TAACAAGGCCTTAAGTCACTGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 38, 3: 112, 4: 491} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!