ID: 1045803814_1045803820

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1045803814 1045803820
Species Human (GRCh38) Human (GRCh38)
Location 8:106133259-106133281 8:106133303-106133325
Sequence CCTTTTGACCTTTTCCACCATGT TTCACCAGAAGCCGAGCAGAAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!