ID: 1045860500_1045860506

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1045860500 1045860506
Species Human (GRCh38) Human (GRCh38)
Location 8:106811032-106811054 8:106811059-106811081
Sequence CCAACCTCCCTCTCCAGGTGAGG GCCTTGAGAACAATGCTGATAGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!