ID: 1045897971_1045897975

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1045897971 1045897975
Species Human (GRCh38) Human (GRCh38)
Location 8:107240973-107240995 8:107241014-107241036
Sequence CCCACGTAGTCTCGCTGATTGCT CAAACTGCAAGGCGGCAGCGAGG
Strand - +
Off-target summary {0: 3, 1: 915, 2: 1490, 3: 993, 4: 935} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!