ID: 1045897972_1045897974

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1045897972 1045897974
Species Human (GRCh38) Human (GRCh38)
Location 8:107240974-107240996 8:107241006-107241028
Sequence CCACGTAGTCTCGCTGATTGCTA TCTGAGATCAAACTGCAAGGCGG
Strand - +
Off-target summary No data {0: 2869, 1: 1007, 2: 456, 3: 293, 4: 360}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!