ID: 1045901525_1045901530

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1045901525 1045901530
Species Human (GRCh38) Human (GRCh38)
Location 8:107287090-107287112 8:107287132-107287154
Sequence CCCTTTTCTGTGCAGTCATTGAA CTCAATGTGAATAAAGAGGCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 24, 4: 201}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!