ID: 1045993836_1045993841

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1045993836 1045993841
Species Human (GRCh38) Human (GRCh38)
Location 8:108340278-108340300 8:108340309-108340331
Sequence CCAGCTACTAGGGAAGTTCAGGC CACTTGAGTCCAGGAGGTCGAGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 818, 3: 20765, 4: 221602} {0: 56, 1: 1202, 2: 8210, 3: 32689, 4: 83127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!