ID: 1046015595_1046015602

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1046015595 1046015602
Species Human (GRCh38) Human (GRCh38)
Location 8:108601095-108601117 8:108601132-108601154
Sequence CCAATTCGAAAGTTATGATTTTT AAGGAGAAGGAGGAGGGAGAGGG
Strand - +
Off-target summary No data {0: 3, 1: 35, 2: 221, 3: 1375, 4: 6840}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!