ID: 1046019990_1046019993

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1046019990 1046019993
Species Human (GRCh38) Human (GRCh38)
Location 8:108653255-108653277 8:108653293-108653315
Sequence CCTGAAGCATTGAAGACAGGAAT TATATTCTTCAGAGCACAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 287} {0: 1, 1: 0, 2: 3, 3: 6, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!