ID: 1046053716_1046053726 |
View in Genome Browser |
Spacer: 24 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1046053716 | 1046053726 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 8:109054831-109054853 | 8:109054878-109054900 |
| Sequence | CCTTCCTCCTCCTCCTGCTCCTT | CTGGAAGTGATTTTGTTATTAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 65, 2: 664, 3: 2188, 4: 6122} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||