ID: 1046130557_1046130564 |
View in Genome Browser |
Spacer: 8 |
| Left Crispr | Right Crispr | |
|---|---|---|
| Crispr ID | 1046130557 | 1046130564 |
| Species | Human (GRCh38) | Human (GRCh38) |
| Location | 8:109962784-109962806 | 8:109962815-109962837 |
| Sequence | CCAACCCTCGTAAAGTGAGGAAA | TAATAGGCACAGATGGAGGTAGG |
| Strand | - | + |
| Off-target summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 101} | No data |
| Status | Not started | |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer | Left Crispr | Right Crispr | ||||||
|---|---|---|---|---|---|---|---|---|
| Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
| No off target data available for this pair! | ||||||||