ID: 1046187064_1046187070

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1046187064 1046187070
Species Human (GRCh38) Human (GRCh38)
Location 8:110734916-110734938 8:110734932-110734954
Sequence CCCTCCATGAGCTCCTAGGTGCC AGGTGCCCAAAGTTTCAGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 181} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!