ID: 1046198478_1046198482

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1046198478 1046198482
Species Human (GRCh38) Human (GRCh38)
Location 8:110892516-110892538 8:110892540-110892562
Sequence CCGCCATAACCGTCAATAAATGC GCTTTGCCCGGAAACTTATCCGG
Strand - +
Off-target summary No data {0: 2, 1: 4, 2: 15, 3: 17, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!