ID: 1046260911_1046260915 |
View in Genome Browser |
Spacer: 11 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1046260911 | 1046260915 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 8:111766204-111766226 | 8:111766238-111766260 |
Sequence | CCTGCGGACAGCTAAGCTGAAAG | ACACACGCCTGTTGGGGCTTCGG |
Strand | - | + |
Off-target summary | {0: 2, 1: 9, 2: 24, 3: 63, 4: 140} | No data |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |