ID: 1046260911_1046260915

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1046260911 1046260915
Species Human (GRCh38) Human (GRCh38)
Location 8:111766204-111766226 8:111766238-111766260
Sequence CCTGCGGACAGCTAAGCTGAAAG ACACACGCCTGTTGGGGCTTCGG
Strand - +
Off-target summary {0: 2, 1: 9, 2: 24, 3: 63, 4: 140} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!