ID: 1046440839_1046440844

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1046440839 1046440844
Species Human (GRCh38) Human (GRCh38)
Location 8:114252101-114252123 8:114252127-114252149
Sequence CCGACCAATTTTTTAAACCCAAT TCTTGTATGCTGTAGCTGCAGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!