ID: 1046489554_1046489558

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1046489554 1046489558
Species Human (GRCh38) Human (GRCh38)
Location 8:114932302-114932324 8:114932351-114932373
Sequence CCCCTCCTCTTTCTGTTTCAACA CTTTCTAGTTGTAGTGTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 5, 3: 53, 4: 619} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!