ID: 1046489790_1046489795

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 1046489790 1046489795
Species Human (GRCh38) Human (GRCh38)
Location 8:114936572-114936594 8:114936591-114936613
Sequence CCTTTACCAGCTGCAGTCAGAGG GAGGAAGATGTGACTATGGGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 195} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!