ID: 1046585783_1046585787 |
View in Genome Browser |
Spacer: 18 |
Left Crispr | Right Crispr | |
---|---|---|
Crispr ID | 1046585783 | 1046585787 |
Species | Human (GRCh38) | Human (GRCh38) |
Location | 8:116147704-116147726 | 8:116147745-116147767 |
Sequence | CCAAAACCCAGTAACAGGCCAAG | GAGTAGTTATTTGCAGAAGATGG |
Strand | - | + |
Off-target summary | No data | {0: 11, 1: 189, 2: 190, 3: 139, 4: 322} |
Status | Not started |
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer | Left Crispr | Right Crispr | ||||||
---|---|---|---|---|---|---|---|---|
Location | Sequence | Mismatches | Strand | Location | Sequence | Mismatches | Strand | |
No off target data available for this pair! |