ID: 1046585783_1046585787

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1046585783 1046585787
Species Human (GRCh38) Human (GRCh38)
Location 8:116147704-116147726 8:116147745-116147767
Sequence CCAAAACCCAGTAACAGGCCAAG GAGTAGTTATTTGCAGAAGATGG
Strand - +
Off-target summary No data {0: 11, 1: 189, 2: 190, 3: 139, 4: 322}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!