ID: 1046664539_1046664544

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1046664539 1046664544
Species Human (GRCh38) Human (GRCh38)
Location 8:116986345-116986367 8:116986366-116986388
Sequence CCTCACCCTAGTGCACTAAGAGC GCCTCTGTAGTCTCCTGGTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 20, 4: 218}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!