ID: 1046678348_1046678360

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1046678348 1046678360
Species Human (GRCh38) Human (GRCh38)
Location 8:117137976-117137998 8:117138027-117138049
Sequence CCATGAACCATATTTTTTTACCC GGTGGGATTCTCTGGGCTTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 24, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!