ID: 1046681115_1046681122

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1046681115 1046681122
Species Human (GRCh38) Human (GRCh38)
Location 8:117171320-117171342 8:117171362-117171384
Sequence CCCACTTATTGATGTTGTCATAG ATTCTTGGGGCTGACTGCAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 151} {0: 1, 1: 0, 2: 3, 3: 32, 4: 380}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!