ID: 1046681116_1046681123

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1046681116 1046681123
Species Human (GRCh38) Human (GRCh38)
Location 8:117171321-117171343 8:117171363-117171385
Sequence CCACTTATTGATGTTGTCATAGC TTCTTGGGGCTGACTGCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 101} {0: 1, 1: 0, 2: 3, 3: 13, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!