ID: 1046704160_1046704164

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1046704160 1046704164
Species Human (GRCh38) Human (GRCh38)
Location 8:117432420-117432442 8:117432450-117432472
Sequence CCTTGCAGGAATGCTGATTCTGT CCATTCCACTCCAGTGTCCATGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 11, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!