ID: 1046815646_1046815651

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1046815646 1046815651
Species Human (GRCh38) Human (GRCh38)
Location 8:118580812-118580834 8:118580834-118580856
Sequence CCTTCACCTTCAATTTGCAGTTT TAATACCTTCAGCATGGGCAGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 4, 3: 22, 4: 311} {0: 2, 1: 0, 2: 3, 3: 14, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!