ID: 1046841138_1046841144

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1046841138 1046841144
Species Human (GRCh38) Human (GRCh38)
Location 8:118858520-118858542 8:118858535-118858557
Sequence CCAATTGCCCACAAAGCCCTGCA GCCCTGCACTATGGGGCTCCTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 22, 4: 211}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!