ID: 1046890421_1046890430

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1046890421 1046890430
Species Human (GRCh38) Human (GRCh38)
Location 8:119416125-119416147 8:119416173-119416195
Sequence CCTGGGAGAAGGCGAAGCAACTT CCACGCGCTCGAGCGAGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 129} {0: 1, 1: 0, 2: 0, 3: 3, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!