ID: 1046925398_1046925409

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1046925398 1046925409
Species Human (GRCh38) Human (GRCh38)
Location 8:119781563-119781585 8:119781599-119781621
Sequence CCAGCTACTTGGGAGGCTGATGT GACTCAGGACGGGGAGGGGGAGG
Strand - +
Off-target summary {0: 203, 1: 14557, 2: 116457, 3: 228136, 4: 284387} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!