ID: 1046952601_1046952612

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1046952601 1046952612
Species Human (GRCh38) Human (GRCh38)
Location 8:120032537-120032559 8:120032585-120032607
Sequence CCTGAAGGTTCCCGAGTGGGACC GTGACCTTGTTGGCTGGTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!