ID: 1046952779_1046952786

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1046952779 1046952786
Species Human (GRCh38) Human (GRCh38)
Location 8:120033949-120033971 8:120033978-120034000
Sequence CCCAGCTCCACCGGGGGCTGAAG ACTTGTTTGAACTCAGGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 16, 3: 811, 4: 23402} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!