ID: 1046978997_1046979008

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1046978997 1046979008
Species Human (GRCh38) Human (GRCh38)
Location 8:120315930-120315952 8:120315976-120315998
Sequence CCTGTTCTACACAGGGTATCCCA TGATGGCTCACCAGGCCAGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 88} {0: 1, 1: 0, 2: 0, 3: 19, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!