ID: 1047022626_1047022629

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1047022626 1047022629
Species Human (GRCh38) Human (GRCh38)
Location 8:120792222-120792244 8:120792263-120792285
Sequence CCATTATTCTAAGTGAAGTAACT TACTGTATGTTCTCATAAGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 19, 2: 98, 3: 158, 4: 425}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!