ID: 1047036954_1047036960

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1047036954 1047036960
Species Human (GRCh38) Human (GRCh38)
Location 8:120950610-120950632 8:120950641-120950663
Sequence CCCGGGTTTAAGTGATTCTCCTG TCCCGAGTAGCTGGGATTACAGG
Strand - +
Off-target summary No data {0: 44204, 1: 206428, 2: 253404, 3: 185491, 4: 423321}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!