ID: 1047036962_1047036963

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1047036962 1047036963
Species Human (GRCh38) Human (GRCh38)
Location 8:120950643-120950665 8:120950660-120950682
Sequence CCGAGTAGCTGGGATTACAGGCA CAGGCACGTGCCACCATGCCCGG
Strand - +
Off-target summary {0: 52453, 1: 101789, 2: 153905, 3: 227834, 4: 315316} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!