ID: 1047063595_1047063599

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1047063595 1047063599
Species Human (GRCh38) Human (GRCh38)
Location 8:121255154-121255176 8:121255180-121255202
Sequence CCCAAAGATGTCAGTGTCTTAAT TGGAACCTGTGAATACATGGTGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 27, 3: 215, 4: 797} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!