ID: 1047173713_1047173718

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1047173713 1047173718
Species Human (GRCh38) Human (GRCh38)
Location 8:122520401-122520423 8:122520445-122520467
Sequence CCTGTGCTTACTTGCTAGTCATG ATGCCTTTACCTCTGTTGTTCGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!