ID: 1047323513_1047323516

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1047323513 1047323516
Species Human (GRCh38) Human (GRCh38)
Location 8:123813083-123813105 8:123813111-123813133
Sequence CCTATACTTTGGGGGATCAAGGG ATGGAACTCTTCCTCTGAAAAGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 8, 3: 123, 4: 2323} {0: 1, 1: 1, 2: 1, 3: 16, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!