ID: 1047325699_1047325705

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1047325699 1047325705
Species Human (GRCh38) Human (GRCh38)
Location 8:123834005-123834027 8:123834037-123834059
Sequence CCTCCCAAAATGCTGGGATTACA TACCATGTCCAGCCACTGGTGGG
Strand - +
Off-target summary {0: 13476, 1: 310447, 2: 266634, 3: 201224, 4: 222235} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!