ID: 1047325702_1047325709

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1047325702 1047325709
Species Human (GRCh38) Human (GRCh38)
Location 8:123834009-123834031 8:123834049-123834071
Sequence CCAAAATGCTGGGATTACAGGCA CCACTGGTGGGAATTTAAAGTGG
Strand - +
Off-target summary {0: 4987, 1: 103398, 2: 243056, 3: 299803, 4: 254654} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!