ID: 1047349528_1047349537

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1047349528 1047349537
Species Human (GRCh38) Human (GRCh38)
Location 8:124060430-124060452 8:124060478-124060500
Sequence CCTGGAGGAACACAGCGTGGTTC CACAGAGCCAGGGCAGGTGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 102} {0: 1, 1: 1, 2: 5, 3: 55, 4: 511}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!